Transcript: Human XM_011513034.1

PREDICTED: Homo sapiens phospholipase A and acyltransferase 1 (PLAAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLAAT1 (57110)
Length:
1135
CDS:
92..1120

Additional Resources:

NCBI RefSeq record:
XM_011513034.1
NBCI Gene record:
PLAAT1 (57110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368332 TGGACAGGAGGTGGCCTATAA pLKO_005 724 CDS 100% 13.200 9.240 N PLAAT1 n/a
2 TRCN0000378532 ATGGCATTCCTGCGTCCTTTA pLKO_005 546 CDS 100% 10.800 7.560 N PLAAT1 n/a
3 TRCN0000378605 CTTGGGTGATGGTTACGTTAT pLKO_005 508 CDS 100% 10.800 7.560 N PLAAT1 n/a
4 TRCN0000378669 TCGCTATGGAGAAGGAGTTTC pLKO_005 784 CDS 100% 10.800 7.560 N PLAAT1 n/a
5 TRCN0000002622 CCTGTACTTGGGTGATGGTTA pLKO.1 502 CDS 100% 4.950 3.465 N PLAAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08700 pDONR223 100% 46.4% 40.9% None (many diffs) n/a
2 ccsbBroad304_08700 pLX_304 0% 46.4% 40.9% V5 (many diffs) n/a
3 TRCN0000480811 AGAATCGCCTAGACTCAGCTCGTA pLX_317 69.8% 46.4% 40.9% V5 (many diffs) n/a
Download CSV