Transcript: Human XM_011513102.2

PREDICTED: Homo sapiens transcription factor Dp-2 (TFDP2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFDP2 (7029)
Length:
9552
CDS:
190..1467

Additional Resources:

NCBI RefSeq record:
XM_011513102.2
NBCI Gene record:
TFDP2 (7029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413300 GAGGCGGATAGAACGGATAAA pLKO_005 801 CDS 100% 13.200 18.480 N TFDP2 n/a
2 TRCN0000019921 CCCTGTTCGTTCAATGATGAA pLKO.1 1405 CDS 100% 4.950 6.930 N TFDP2 n/a
3 TRCN0000416056 CACCAATTCAAATAACCATTT pLKO_005 609 CDS 100% 10.800 8.640 N TFDP2 n/a
4 TRCN0000420624 GAACTCTACCCAATCAGTTTC pLKO_005 1221 CDS 100% 10.800 8.640 N TFDP2 n/a
5 TRCN0000419684 CTAATGGCAATGAACATAATT pLKO_005 697 CDS 100% 15.000 10.500 N TFDP2 n/a
6 TRCN0000434641 TGATGACATAGAAGTACTAAA pLKO_005 1053 CDS 100% 13.200 9.240 N TFDP2 n/a
7 TRCN0000095782 CCACAGGACCTTCTTGGTTAA pLKO.1 1184 CDS 100% 10.800 7.560 N Tfdp2 n/a
8 TRCN0000019923 GAGGATCTGAAACTTGCGAAA pLKO.1 1120 CDS 100% 4.050 2.835 N TFDP2 n/a
9 TRCN0000095781 CCTACCAATTCTGCTCAGGAA pLKO.1 754 CDS 100% 2.640 1.848 N Tfdp2 n/a
10 TRCN0000019920 CGAAGAGTTTATGATGCTTTA pLKO.1 670 CDS 100% 10.800 6.480 N TFDP2 n/a
11 TRCN0000019919 GCTGAGATGATTGAGATGAAA pLKO.1 1620 3UTR 100% 5.625 3.375 N TFDP2 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7119 3UTR 100% 4.950 2.475 Y n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5115 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5115 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01662 pDONR223 100% 90.6% 90.5% None 1_117del;119_120delCAinsTG n/a
2 ccsbBroad304_01662 pLX_304 0% 90.6% 90.5% V5 1_117del;119_120delCAinsTG n/a
3 TRCN0000473496 ATCACGGCATTTAAGGAGTGGGGT pLX_317 45.4% 90.6% 90.5% V5 1_117del;119_120delCAinsTG n/a
Download CSV