Transcript: Human XM_011513246.3

PREDICTED: Homo sapiens centrosomal protein 19 (CEP19), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP19 (84984)
Length:
1941
CDS:
160..663

Additional Resources:

NCBI RefSeq record:
XM_011513246.3
NBCI Gene record:
CEP19 (84984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172663 GCGCATTATGCCAGTTCGAAA pLKO.1 264 CDS 100% 4.950 6.930 N CEP19 n/a
2 TRCN0000282778 CCAGAGCTGCTGAACAATTAA pLKO_005 308 CDS 100% 15.000 10.500 N CEP19 n/a
3 TRCN0000263711 GTTTCAGCCTCCAGCTATTAT pLKO_005 204 CDS 100% 15.000 10.500 N CEP19 n/a
4 TRCN0000263712 TGGGAAATCCACCCATAATAA pLKO_005 1734 3UTR 100% 15.000 10.500 N CEP19 n/a
5 TRCN0000282780 GGCAGAAACAATGGAACAAAT pLKO_005 429 CDS 100% 13.200 9.240 N CEP19 n/a
6 TRCN0000282782 TATGACATTGAGGTTGAATTT pLKO_005 583 CDS 100% 13.200 9.240 N CEP19 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 903 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 904 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 976 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12898 pDONR223 100% 97.6% 97.6% None 1_12del n/a
2 ccsbBroad304_12898 pLX_304 0% 97.6% 97.6% V5 1_12del n/a
3 TRCN0000466177 ATCTAAACCGTCTGAATTAATACA pLX_317 59.7% 97.6% 97.6% V5 1_12del n/a
Download CSV