Transcript: Human XM_011513594.3

PREDICTED: Homo sapiens transmembrane protein 129 (TMEM129), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM129 (92305)
Length:
2289
CDS:
192..1061

Additional Resources:

NCBI RefSeq record:
XM_011513594.3
NBCI Gene record:
TMEM129 (92305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180419 GCATCCTGATCTACTACTGGT pLKO.1 295 CDS 100% 2.640 2.112 N TMEM129 n/a
2 TRCN0000242619 CTGGCAAAGGGCTCTACTTAA pLKO_005 1140 3UTR 100% 13.200 9.240 N TMEM129 n/a
3 TRCN0000180739 GCCTTACTTCTCTGGAGCATA pLKO.1 1419 3UTR 100% 4.950 3.465 N TMEM129 n/a
4 TRCN0000242616 TCGCCTGCATCCTGATCTACT pLKO_005 289 CDS 100% 4.950 3.465 N TMEM129 n/a
5 TRCN0000242618 ACGTGGGTGATGAAGGTAACC pLKO_005 477 CDS 100% 4.050 2.835 N TMEM129 n/a
6 TRCN0000180563 GTTGAGGACCAAAGTGCCATA pLKO.1 1773 3UTR 100% 4.050 2.835 N TMEM129 n/a
7 TRCN0000242617 TTGCCTCCTCTGTCAACACTG pLKO_005 394 CDS 100% 4.050 2.835 N TMEM129 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04575 pDONR223 100% 79.8% 79.8% None 0_1ins219 n/a
2 ccsbBroad304_04575 pLX_304 0% 79.8% 79.8% V5 0_1ins219 n/a
3 TRCN0000476429 AAGTAAGTGTTAATCTAGTACCCT pLX_317 31.1% 79.8% 79.8% V5 0_1ins219 n/a
4 TRCN0000467129 AATGAGAAATCGCCCGGTTAGTGC pLX_317 61% 43.5% 42.5% V5 (many diffs) n/a
5 ccsbBroadEn_09335 pDONR223 100% 43.2% 41.9% None (many diffs) n/a
6 ccsbBroad304_09335 pLX_304 0% 43.2% 41.9% V5 (many diffs) n/a
Download CSV