Transcript: Human XM_011513595.1

PREDICTED: Homo sapiens transcriptional adaptor 2B (TADA2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TADA2B (93624)
Length:
4992
CDS:
1108..2094

Additional Resources:

NCBI RefSeq record:
XM_011513595.1
NBCI Gene record:
TADA2B (93624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237951 CGTGACTGTGAAGACTATTAT pLKO_005 1938 CDS 100% 15.000 21.000 N TADA2B n/a
2 TRCN0000237947 GATTGCCAGACGTACTATATT pLKO_005 4166 3UTR 100% 15.000 21.000 N TADA2B n/a
3 TRCN0000237949 ATGATTACGAGATCGAGTATG pLKO_005 1343 CDS 100% 10.800 15.120 N TADA2B n/a
4 TRCN0000237948 TACCTGGACAAAGTCCTAAAG pLKO_005 2017 CDS 100% 0.000 0.000 N TADA2B n/a
5 TRCN0000237950 ACATCGCCCGTGACTACAATC pLKO_005 1493 CDS 100% 10.800 6.480 N TADA2B n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4642 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4566 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4567 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4639 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12999 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12999 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471791 TCACGCAAGCCACTCCTGCTGTTC pLX_317 37.2% 100% 100% V5 n/a
Download CSV