Transcript: Human XM_011513598.3

PREDICTED: Homo sapiens KIAA0232 (KIAA0232), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0232 (9778)
Length:
6427
CDS:
438..4376

Additional Resources:

NCBI RefSeq record:
XM_011513598.3
NBCI Gene record:
KIAA0232 (9778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168466 GCCATGATTTACACTCGGTAT pLKO.1 17 5UTR 100% 4.050 5.670 N KIAA0232 n/a
2 TRCN0000347229 ACTTCTATGAAGTGGATATTG pLKO_005 1639 CDS 100% 13.200 10.560 N D5Ertd579e n/a
3 TRCN0000136265 GCTTCTGATGTTGTGACGATA pLKO.1 3003 CDS 100% 4.950 3.960 N KIAA0232 n/a
4 TRCN0000277681 ACGTGGATGGTGGTGATTATA pLKO_005 2830 CDS 100% 15.000 10.500 N KIAA0232 n/a
5 TRCN0000277621 AGTGAGACCTGTTAATCTAAA pLKO_005 4436 3UTR 100% 13.200 9.240 N KIAA0232 n/a
6 TRCN0000133951 CCTGGACTTGAATACTCATTT pLKO.1 3213 CDS 100% 13.200 9.240 N KIAA0232 n/a
7 TRCN0000277622 CCTGGACTTGAATACTCATTT pLKO_005 3213 CDS 100% 13.200 9.240 N KIAA0232 n/a
8 TRCN0000168707 GCAGGCAGTAAACACACATAT pLKO.1 5776 3UTR 100% 13.200 9.240 N KIAA0232 n/a
9 TRCN0000347236 TACTTTCATTGATGGTCATTT pLKO_005 1505 CDS 100% 13.200 9.240 N D5Ertd579e n/a
10 TRCN0000134944 GCAGAATGTTGCATAGTGTTA pLKO.1 1761 CDS 100% 4.950 3.465 N KIAA0232 n/a
11 TRCN0000277623 GCAGAATGTTGCATAGTGTTA pLKO_005 1761 CDS 100% 4.950 3.465 N KIAA0232 n/a
12 TRCN0000135056 CCTTTGACTTAAGCAATCCAT pLKO.1 3238 CDS 100% 3.000 2.100 N KIAA0232 n/a
13 TRCN0000277620 CCTTTGACTTAAGCAATCCAT pLKO_005 3238 CDS 100% 3.000 2.100 N KIAA0232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07483 pDONR223 100% 90.7% 90.6% None (many diffs) n/a
2 ccsbBroad304_07483 pLX_304 0% 90.7% 90.6% V5 (many diffs) n/a
3 TRCN0000479299 ATATGACTAGACACAAACCTCCTA pLX_317 9.8% 90.7% 90.6% V5 (many diffs) n/a
Download CSV