Transcript: Human XM_011513632.2

PREDICTED: Homo sapiens cytochrome c oxidase subunit 7B2 (COX7B2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COX7B2 (170712)
Length:
835
CDS:
470..715

Additional Resources:

NCBI RefSeq record:
XM_011513632.2
NBCI Gene record:
COX7B2 (170712)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431500 GGCAAGACATAGCCATGTAAA pLKO_005 535 CDS 100% 13.200 9.240 N COX7B2 n/a
2 TRCN0000046308 CCACTCAGATTGGAATAGAAT pLKO.1 642 CDS 100% 5.625 3.938 N COX7B2 n/a
3 TRCN0000046311 AGTCTCAAGATTCAAAGCATT pLKO.1 503 CDS 100% 4.950 3.465 N COX7B2 n/a
4 TRCN0000046309 CTGCAAAGCATGGCAAGACAT pLKO.1 524 CDS 100% 4.950 3.465 N COX7B2 n/a
5 TRCN0000046312 CTGCTTTCTGTGTTGCTACAT pLKO.1 609 CDS 100% 4.950 3.465 N COX7B2 n/a
6 TRCN0000046310 CTGTGTTGCTACATGGGTGTT pLKO.1 616 CDS 100% 4.050 2.835 N COX7B2 n/a
7 TRCN0000432204 TGATAAATATGGTAATGCTGT pLKO_005 574 CDS 100% 2.640 1.848 N COX7B2 n/a
8 TRCN0000428971 GGAATAGAATGGAACCTATCC pLKO_005 653 CDS 100% 4.050 2.430 N COX7B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13362 pDONR223 100% 98.7% 98.7% None 1_3delATG n/a
2 ccsbBroad304_13362 pLX_304 0% 98.7% 98.7% V5 1_3delATG n/a
3 TRCN0000466195 TACCCTATTAGCATTCAATTGTTA pLX_317 100% 98.7% 98.7% V5 1_3delATG n/a
Download CSV