Transcript: Human XM_011513712.2

PREDICTED: Homo sapiens chromosome 4 open reading frame 19 (C4orf19), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C4orf19 (55286)
Length:
6338
CDS:
248..1192

Additional Resources:

NCBI RefSeq record:
XM_011513712.2
NBCI Gene record:
C4orf19 (55286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263755 ATCGCAAGTGACCTCTATATA pLKO_005 3238 3UTR 100% 15.000 21.000 N C4orf19 n/a
2 TRCN0000172686 GCAAGCTAGATGAAGACGACA pLKO.1 339 CDS 100% 2.640 3.696 N C4orf19 n/a
3 TRCN0000263753 ATGAAGACGACACTGATAAAT pLKO_005 348 CDS 100% 15.000 10.500 N C4orf19 n/a
4 TRCN0000167363 GTTCTAAGCATCTGCTTTAAT pLKO.1 995 CDS 100% 15.000 10.500 N C4orf19 n/a
5 TRCN0000263754 TGGAGACAACGTTGATCATAA pLKO_005 832 CDS 100% 13.200 9.240 N C4orf19 n/a
6 TRCN0000282798 GGGACCCAAGTCATGAGAAAT pLKO_005 707 CDS 100% 13.200 7.920 N C4orf19 n/a
7 TRCN0000263752 AGGAGAAGCTGGGATTCATTG pLKO_005 953 CDS 100% 10.800 6.480 N C4orf19 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2139 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03572 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03572 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469204 ATCCCGAAGAGTATTCTTGCTGCA pLX_317 44.8% 100% 100% V5 n/a
Download CSV