Transcript: Human XM_011513741.1

PREDICTED: Homo sapiens tec protein tyrosine kinase (TEC), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEC (7006)
Length:
1592
CDS:
46..1446

Additional Resources:

NCBI RefSeq record:
XM_011513741.1
NBCI Gene record:
TEC (7006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145649 GGAAGGTGCAATGTGCGAGG pXPR_003 AGG 1492 89% 13 0.6006 TEC TEC 77025
2 BRDN0001148069 CATGATCTCAGATTAGAGAG pXPR_003 AGG 875 52% 7 0.576 TEC TEC 77024
3 BRDN0001147924 TCTTCCCTTTCACACTAACT pXPR_003 GGG 1307 78% 12 -0.0850 TEC TEC 77023
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009992 GAGCCCAGTACAAAGTCGCAA pLKO.1 1214 CDS 100% 2.640 3.696 N TEC n/a
2 TRCN0000342492 GAGCCCAGTACAAAGTCGCAA pLKO_005 1214 CDS 100% 2.640 3.696 N TEC n/a
3 TRCN0000009984 CTCCTCCGCAGTGAAGATAAA pLKO.1 823 CDS 100% 13.200 9.240 N TEC n/a
4 TRCN0000196560 GAAGGATATATCCCAAGTAAT pLKO.1 721 CDS 100% 13.200 9.240 N TEC n/a
5 TRCN0000009982 GCACCCAGCAGAAACCAATAT pLKO.1 1340 CDS 100% 13.200 9.240 N TEC n/a
6 TRCN0000342494 TATGAGAAATGGGAGATTAAC pLKO_005 1123 CDS 100% 13.200 9.240 N TEC n/a
7 TRCN0000009983 AGTATCCATTTCAGGTTGTTC pLKO.1 275 CDS 100% 4.950 3.465 N TEC n/a
8 TRCN0000009993 CACAGTCTCCCTTTATACCAA pLKO.1 888 CDS 100% 3.000 2.100 N TEC n/a
9 TRCN0000342491 CACAGTCTCCCTTTATACCAA pLKO_005 888 CDS 100% 3.000 2.100 N TEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14859 pDONR223 0% 73.8% 73% None 1374_1375ins95;1398_1399ins400 n/a
2 TRCN0000473405 CGGCTAAAATTGACTCAAGCCGTC pLX_317 24.2% 73.8% 73% V5 1374_1375ins95;1398_1399ins400 n/a
3 TRCN0000488805 TTTTCTCAAGTCATATTGCATGAA pLX_317 16.9% 73.7% 73% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV