Transcript: Human XM_011513748.3

PREDICTED: Homo sapiens TXK tyrosine kinase (TXK), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TXK (7294)
Length:
5091
CDS:
89..958

Additional Resources:

NCBI RefSeq record:
XM_011513748.3
NBCI Gene record:
TXK (7294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146212 TGGTCCATTTAGGTGAATGG pXPR_003 CGG 153 18% 3 0.2458 TXK TXK 76360
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121108 CCTACACAATTTCCGTATTTA pLKO.1 50 5UTR 100% 15.000 21.000 N TXK n/a
2 TRCN0000121180 GCACCAATGTCCATATATGAA pLKO.1 845 CDS 100% 5.625 7.875 N TXK n/a
3 TRCN0000195084 CAAGGAATTGTTTGGTCAGTT pLKO.1 552 CDS 100% 4.950 6.930 N TXK n/a
4 TRCN0000009998 CCGTATTTATGGGAGCTAGAA pLKO.1 62 5UTR 100% 4.950 6.930 N TXK n/a
5 TRCN0000055429 CCGTATTTATGGGAGCTAGAA pLKO.1 62 5UTR 100% 4.950 6.930 N TXK n/a
6 TRCN0000121111 CCTTTACATTGTGACAGAGTT pLKO.1 388 CDS 100% 4.950 6.930 N TXK n/a
7 TRCN0000196957 GCAAGTCGTGGAAGCTATTTC pLKO.1 793 CDS 100% 13.200 10.560 N TXK n/a
8 TRCN0000194951 CAGTGATCCATGCATAGAATA pLKO.1 1338 3UTR 100% 13.200 9.240 N TXK n/a
9 TRCN0000194938 CAGTTCAACATGCATAGTAAA pLKO.1 568 CDS 100% 13.200 9.240 N TXK n/a
10 TRCN0000314836 CAGTTCAACATGCATAGTAAA pLKO_005 568 CDS 100% 13.200 9.240 N TXK n/a
11 TRCN0000121107 CCCTTGAAGAATTTCATGTTT pLKO.1 1398 3UTR 100% 5.625 3.938 N TXK n/a
12 TRCN0000196365 GCACCTTTATAAATCACATGA pLKO.1 1447 3UTR 100% 4.950 3.465 N TXK n/a
13 TRCN0000314838 GCACCTTTATAAATCACATGA pLKO_005 1447 3UTR 100% 4.950 3.465 N TXK n/a
14 TRCN0000121177 GCCAACCCAAAGAGTCATCTT pLKO.1 972 3UTR 100% 4.950 3.465 N TXK n/a
15 TRCN0000314784 GCCAACCCAAAGAGTCATCTT pLKO_005 972 3UTR 100% 4.950 3.465 N TXK n/a
16 TRCN0000121288 GTCCATATATGAAGTCATGTA pLKO.1 853 CDS 100% 4.950 3.465 N TXK n/a
17 TRCN0000001577 GAAACAGAATGCCAACCCAAA pLKO.1 962 3UTR 100% 4.050 2.835 N TXK n/a
18 TRCN0000314837 GAAACAGAATGCCAACCCAAA pLKO_005 962 3UTR 100% 4.050 2.835 N TXK n/a
19 TRCN0000121109 GCTTAACTATCTCAGGGAGAA pLKO.1 427 CDS 100% 4.050 2.835 N TXK n/a
20 TRCN0000121291 TGCTGGCATGAGAAACCTGAA pLKO.1 878 CDS 100% 4.050 2.835 N TXK n/a
21 TRCN0000001580 GCTGCCTGCTTAACTATCTCA pLKO.1 420 CDS 100% 3.000 2.100 N TXK n/a
22 TRCN0000314783 GCTGCCTGCTTAACTATCTCA pLKO_005 420 CDS 100% 3.000 2.100 N TXK n/a
23 TRCN0000121179 GCTGTCACAGAGATTGCGGAA pLKO.1 929 CDS 100% 2.160 1.512 N TXK n/a
24 TRCN0000121178 CCAGGATATATGTGAAGGAAT pLKO.1 487 CDS 100% 4.950 2.970 N TXK n/a
25 TRCN0000121287 CCCAAATGTGAAGAAGTGAAA pLKO.1 1196 3UTR 100% 4.950 2.970 N TXK n/a
26 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3314 3UTR 100% 4.950 2.475 Y ORAI2 n/a
27 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3403 3UTR 100% 10.800 5.400 Y SMIM11A n/a
28 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3311 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14869 pDONR223 0% 54.8% 54.8% None 0_1ins714 n/a
2 ccsbBroad304_14869 pLX_304 0% 54.8% 54.8% V5 0_1ins714 n/a
Download CSV