Transcript: Human XM_011513848.1

PREDICTED: Homo sapiens Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase (SEPSECS), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPSECS (51091)
Length:
5879
CDS:
637..1962

Additional Resources:

NCBI RefSeq record:
XM_011513848.1
NBCI Gene record:
SEPSECS (51091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434917 TGATCCTTAACAGGTTATAAT pLKO_005 2155 3UTR 100% 15.000 21.000 N SEPSECS n/a
2 TRCN0000127512 CGGTGATATTTCTGCTGTGCA pLKO.1 750 CDS 100% 2.640 3.696 N SEPSECS n/a
3 TRCN0000248930 CCAGTAGGTGGTGCTATAATT pLKO_005 1321 CDS 100% 15.000 10.500 N Sepsecs n/a
4 TRCN0000425956 CCAGTAGGTGGTGCTATAATT pLKO_005 1321 CDS 100% 15.000 10.500 N SEPSECS n/a
5 TRCN0000433478 GCTGTGATTTGTGCTAATTAT pLKO_005 1171 CDS 100% 15.000 10.500 N SEPSECS n/a
6 TRCN0000257819 TTGGACGATCCGGTGATATTT pLKO_005 740 CDS 100% 15.000 10.500 N Sepsecs n/a
7 TRCN0000420444 ACTGGTTGCTCGTCGTCATTA pLKO_005 702 CDS 100% 13.200 9.240 N SEPSECS n/a
8 TRCN0000130113 CACCTCACAATCCCATATCTT pLKO.1 1553 CDS 100% 5.625 3.938 N SEPSECS n/a
9 TRCN0000129178 CTAGATGAACACCGTGACAAA pLKO.1 1594 CDS 100% 4.950 3.465 N SEPSECS n/a
10 TRCN0000130365 GCAGTCTTCAAAGTGTATGCA pLKO.1 1227 CDS 100% 3.000 2.100 N SEPSECS n/a
11 TRCN0000128184 CCTCACAATCCCATATCTTTA pLKO.1 1555 CDS 100% 13.200 7.920 N SEPSECS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11945 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11945 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_11946 pDONR223 100% 88.2% 88.2% None 0_1ins177 n/a
Download CSV