Transcript: Human XM_011513945.1

PREDICTED: Homo sapiens terminal nucleotidyltransferase 4A (TENT4A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENT4A (11044)
Length:
3634
CDS:
35..1534

Additional Resources:

NCBI RefSeq record:
XM_011513945.1
NBCI Gene record:
TENT4A (11044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365178 ACGGCTGATGTACAGATATTT pLKO_005 116 CDS 100% 15.000 21.000 N TENT4A n/a
2 TRCN0000053035 CGGATCGAAACTGTGGTGAAA pLKO.1 83 CDS 100% 4.950 6.930 N TENT4A n/a
3 TRCN0000053037 CCGTGTTCCATCAAAGTCCTT pLKO.1 260 CDS 100% 2.640 3.696 N TENT4A n/a
4 TRCN0000053034 CGAGCCCTCATCTGTATCATA pLKO.1 1317 CDS 100% 5.625 4.500 N TENT4A n/a
5 TRCN0000377474 ACCTGGTGGTCTTCGGGAAAT pLKO_005 180 CDS 100% 10.800 7.560 N TENT4A n/a
6 TRCN0000377473 ACTACCGGAGGTGGATCAAAG pLKO_005 783 CDS 100% 10.800 7.560 N TENT4A n/a
7 TRCN0000053036 CCAACAATCAGACCAGGTTTA pLKO.1 1164 CDS 100% 10.800 7.560 N TENT4A n/a
8 TRCN0000053033 GCAGCTTTAGTACAGGTCTTT pLKO.1 138 CDS 100% 4.950 3.465 N TENT4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02605 pDONR223 100% 92% 92% None 364_365ins129 n/a
2 ccsbBroad304_02605 pLX_304 0% 92% 92% V5 364_365ins129 n/a
3 TRCN0000469345 TTTTTCCTTGTAATGGAGCAAATT pLX_317 17.8% 92% 92% V5 364_365ins129 n/a
4 ccsbBroadEn_07732 pDONR223 100% 92% 92% None 364_365ins129;663T>C n/a
5 ccsbBroad304_07732 pLX_304 0% 92% 92% V5 364_365ins129;663T>C n/a
6 TRCN0000475778 ACCTAGCGGCTTCTTATGCTTCAA pLX_317 21.2% 92% 92% V5 364_365ins129;663T>C n/a
Download CSV