Transcript: Human XM_011514597.2

PREDICTED: Homo sapiens BCL2 interacting protein 5 (BNIP5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BNIP5 (389384)
Length:
3863
CDS:
309..2264

Additional Resources:

NCBI RefSeq record:
XM_011514597.2
NBCI Gene record:
BNIP5 (389384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426505 TTAGCTTAGCTAACAAATTTG pLKO_005 2119 CDS 100% 13.200 18.480 N BNIP5 n/a
2 TRCN0000168846 GCCTAAGAGACCACTACAATT pLKO.1 2176 CDS 100% 13.200 10.560 N BNIP5 n/a
3 TRCN0000435478 AGCTGTGTCTTGCACTCAAAT pLKO_005 2266 3UTR 100% 13.200 9.240 N BNIP5 n/a
4 TRCN0000436091 CACAAGTCCTAAGGTTGAAAG pLKO_005 2234 CDS 100% 10.800 7.560 N BNIP5 n/a
5 TRCN0000168552 GTACTGGAGCTTTGGATGTTT pLKO.1 964 CDS 100% 5.625 3.938 N BNIP5 n/a
6 TRCN0000168867 CCATAAGAAACACACCTCCAA pLKO.1 1637 CDS 100% 2.640 1.848 N BNIP5 n/a
7 TRCN0000168411 GCTGTTAGGAAGAAATCCCAA pLKO.1 1149 CDS 100% 2.640 1.848 N BNIP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05602 pDONR223 100% 99.8% 99.8% None 1168_1169insAAG n/a
2 ccsbBroad304_05602 pLX_304 0% 99.8% 99.8% V5 1168_1169insAAG n/a
3 TRCN0000476067 CTAGTCACTTACCCACCAATCCGC pLX_317 15% 99.8% 99.8% V5 1168_1169insAAG n/a
Download CSV