Transcript: Human XM_011514700.3

PREDICTED: Homo sapiens 3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1 (HMGCLL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMGCLL1 (54511)
Length:
1029
CDS:
154..963

Additional Resources:

NCBI RefSeq record:
XM_011514700.3
NBCI Gene record:
HMGCLL1 (54511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062415 CGGCATGGGTTGTTATGAGAT pLKO.1 777 CDS 100% 4.950 6.930 N HMGCLL1 n/a
2 TRCN0000062417 GCAAATATCCTTACGGCCCTT pLKO.1 925 CDS 100% 2.160 1.728 N HMGCLL1 n/a
3 TRCN0000062416 CCTGTCCTTACTCCTAATCTT pLKO.1 508 CDS 100% 5.625 3.938 N HMGCLL1 n/a
4 TRCN0000062414 CCATTGAAGAAAGTATGGGAA pLKO.1 623 CDS 100% 2.640 1.848 N HMGCLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03427 pDONR223 100% 78.3% 78.2% None 796_798delACC;803_804delTCinsGA;807_808ins216 n/a
2 ccsbBroad304_03427 pLX_304 0% 78.3% 78.2% V5 796_798delACC;803_804delTCinsGA;807_808ins216 n/a
3 TRCN0000474885 TCCCGTCAATATCTAATATACCAC pLX_317 49.9% 78.3% 78.2% V5 796_798delACC;803_804delTCinsGA;807_808ins216 n/a
Download CSV