Transcript: Human XM_011514788.1

PREDICTED: Homo sapiens Rh associated glycoprotein (RHAG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHAG (6005)
Length:
830
CDS:
63..716

Additional Resources:

NCBI RefSeq record:
XM_011514788.1
NBCI Gene record:
RHAG (6005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083260 GCCAACAGACATGGGCATATT pLKO.1 182 CDS 100% 13.200 18.480 N RHAG n/a
2 TRCN0000083261 GCATACTACTCAGACTTGTTT pLKO.1 672 CDS 100% 5.625 7.875 N RHAG n/a
3 TRCN0000083262 CCTCTGACATTGGAGCATCAA pLKO.1 556 CDS 100% 4.950 3.960 N RHAG n/a
4 TRCN0000083259 CCCACAATGAATACCTGGTTA pLKO.1 520 CDS 100% 4.950 3.465 N RHAG n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 777 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 778 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13943 pDONR223 100% 51.9% 51.5% None (many diffs) n/a
2 ccsbBroad304_13943 pLX_304 0% 51.9% 51.5% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466091 CTTTGAAACAGTCTTCAAGCCCTT pLX_317 24.7% 51.9% 51.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV