Transcript: Human XM_011514821.2

PREDICTED: Homo sapiens solute carrier family 17 member 1 (SLC17A1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC17A1 (6568)
Length:
1875
CDS:
84..1274

Additional Resources:

NCBI RefSeq record:
XM_011514821.2
NBCI Gene record:
SLC17A1 (6568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045003 GCCGACTTACTTCTATGAGTA pLKO.1 373 CDS 100% 4.950 6.930 N SLC17A1 n/a
2 TRCN0000435851 GATACTTCTCTGGAATATATT pLKO_005 166 CDS 100% 15.000 10.500 N SLC17A1 n/a
3 TRCN0000045006 CCAGGAATATTCTCAGCGTAA pLKO.1 850 CDS 100% 4.050 2.835 N SLC17A1 n/a
4 TRCN0000045004 GCTTGGATATTGCTCCCAGAT pLKO.1 1030 CDS 100% 4.050 2.835 N SLC17A1 n/a
5 TRCN0000417072 TTAATGTGACTGGCCTAATTT pLKO_005 1186 CDS 100% 15.000 9.000 N SLC17A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13958 pDONR223 100% 84.6% 50.5% None 0_1ins213;700_701insC;803T>C n/a
2 ccsbBroad304_13958 pLX_304 0% 84.6% 50.5% V5 (not translated due to prior stop codon) 0_1ins213;700_701insC;803T>C n/a
3 TRCN0000476468 CGACTCAACAATTCTGACGCCGTA pLX_317 22.8% 84.6% 50.5% V5 (not translated due to prior stop codon) 0_1ins213;700_701insC;803T>C n/a
Download CSV