Transcript: Human XM_011514912.3

PREDICTED: Homo sapiens olfactory receptor family 2 subfamily H member 2 (OR2H2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR2H2 (7932)
Length:
5491
CDS:
1422..2324

Additional Resources:

NCBI RefSeq record:
XM_011514912.3
NBCI Gene record:
OR2H2 (7932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357826 CGATCGGCAGGTGGATGATTT pLKO_005 1925 CDS 100% 13.200 18.480 N OR2H2 n/a
2 TRCN0000357829 TTGTCTCTTACGGAGCCATTA pLKO_005 2059 CDS 100% 10.800 15.120 N OR2H2 n/a
3 TRCN0000357828 CTGTGAGGTCCCAGCTCTAAT pLKO_005 1949 CDS 100% 13.200 9.240 N OR2H2 n/a
4 TRCN0000011789 CTCTGTTTCACCACGAGTTGT pLKO.1 1626 CDS 100% 4.950 3.465 N OR2H2 n/a
5 TRCN0000009369 CTTGTCTCTTACGGAGCCATT pLKO.1 2058 CDS 100% 4.050 2.835 N OR2H2 n/a
6 TRCN0000357827 TCCTACCTCCTAACCCTAGTG pLKO_005 1515 CDS 100% 4.050 2.835 N OR2H2 n/a
7 TRCN0000011788 CCTGGGCAGTGCTGAGGATTA pLKO.1 2080 CDS 100% 3.600 2.520 N OR2H2 n/a
8 TRCN0000009370 ACTTCCTACCTCCTAACCCTA pLKO.1 1512 CDS 100% 2.640 1.848 N OR2H2 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4072 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000009371 CCTCTTCTACAGCTCAGTCAT pLKO.1 2162 CDS 100% 4.950 2.475 Y OR2H2 n/a
11 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4062 3UTR 100% 13.200 6.600 Y IQCC n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4069 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02970 pDONR223 100% 86.3% 82.9% None (many diffs) n/a
2 ccsbBroad304_02970 pLX_304 0% 86.3% 82.9% V5 (many diffs) n/a
3 TRCN0000468029 GAGGTTACCGTCTGTAGGGCAGGT pLX_317 35.5% 86.3% 82.9% V5 (many diffs) n/a
Download CSV