Transcript: Human XM_011515093.2

PREDICTED: Homo sapiens insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGF2BP3 (10643)
Length:
2792
CDS:
104..1564

Additional Resources:

NCBI RefSeq record:
XM_011515093.2
NBCI Gene record:
IGF2BP3 (10643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293596 GAAACTTCAGATACGAAATAT pLKO_005 52 5UTR 100% 15.000 21.000 N IGF2BP3 n/a
2 TRCN0000074677 GCAGGAATTGACGCTGTATAA pLKO.1 769 CDS 100% 13.200 18.480 N IGF2BP3 n/a
3 TRCN0000286206 GCAGGAATTGACGCTGTATAA pLKO_005 769 CDS 100% 13.200 18.480 N IGF2BP3 n/a
4 TRCN0000293594 TCTGCGGCTTGTAAGTCTATT pLKO_005 584 CDS 100% 13.200 18.480 N IGF2BP3 n/a
5 TRCN0000293595 TGTTGTAGTCTCACAGTATAA pLKO_005 1842 3UTR 100% 13.200 9.240 N IGF2BP3 n/a
6 TRCN0000074676 GCAGTTGTAAATGTAACCTAT pLKO.1 182 CDS 100% 4.950 3.465 N IGF2BP3 n/a
7 TRCN0000074675 CGGTGAATGAACTTCAGAATT pLKO.1 1350 CDS 100% 0.000 0.000 N IGF2BP3 n/a
8 TRCN0000286268 CGGTGAATGAACTTCAGAATT pLKO_005 1350 CDS 100% 0.000 0.000 N IGF2BP3 n/a
9 TRCN0000074674 GCACATTTAATTCCTGGATTA pLKO.1 908 CDS 100% 10.800 6.480 N IGF2BP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07663 pDONR223 100% 83.7% 83.5% None (many diffs) n/a
2 ccsbBroad304_07663 pLX_304 0% 83.7% 83.5% V5 (many diffs) n/a
3 TRCN0000492210 CGTCCGTTCGGGGGCACGCAGCCG pLX_317 25.2% 83.7% 83.5% V5 (many diffs) n/a
Download CSV