Transcript: Human XM_011515115.3

PREDICTED: Homo sapiens FKBP prolyl isomerase 9 (FKBP9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FKBP9 (11328)
Length:
3254
CDS:
148..1227

Additional Resources:

NCBI RefSeq record:
XM_011515115.3
NBCI Gene record:
FKBP9 (11328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515115.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054191 CGAGAGACGTTTCGTGAAGAT pLKO.1 459 CDS 100% 4.950 6.930 N FKBP9 n/a
2 TRCN0000291344 CGAGAGACGTTTCGTGAAGAT pLKO_005 459 CDS 100% 4.950 6.930 N FKBP9 n/a
3 TRCN0000054192 GACTCCACTTTCAATGTGTTT pLKO.1 379 CDS 100% 4.950 3.465 N FKBP9 n/a
4 TRCN0000291347 GACTCCACTTTCAATGTGTTT pLKO_005 379 CDS 100% 4.950 3.465 N FKBP9 n/a
5 TRCN0000054189 GCCTACGGAAATGAAGGAGTT pLKO.1 493 CDS 100% 4.050 2.430 N FKBP9 n/a
6 TRCN0000291345 GCCTACGGAAATGAAGGAGTT pLKO_005 493 CDS 100% 4.050 2.430 N FKBP9 n/a
7 TRCN0000054188 CGCACGTTTGACACGTACATT pLKO.1 1054 CDS 100% 5.625 2.813 Y FKBP9 n/a
8 TRCN0000291346 CGCACGTTTGACACGTACATT pLKO_005 1054 CDS 100% 5.625 2.813 Y FKBP9 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2105 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2027 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2028 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2102 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515115.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02673 pDONR223 100% 61.8% 60.8% None (many diffs) n/a
2 ccsbBroad304_02673 pLX_304 0% 61.8% 60.8% V5 (many diffs) n/a
3 TRCN0000476251 AAATTTCCCTTGACGTACATGCCT pLX_317 14% 61.8% 60.8% V5 (many diffs) n/a
Download CSV