Construct: ORF TRCN0000476251
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014015.1_s317c1
- Derived from:
- ccsbBroadEn_02673
- DNA Barcode:
- AAATTTCCCTTGACGTACATGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FKBP9 (11328)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476251
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11328 | FKBP9 | FKBP prolyl isomerase 9 | NM_007270.5 | 100% | 100% | |
2 | human | 11328 | FKBP9 | FKBP prolyl isomerase 9 | NM_001284341.1 | 91.4% | 91.4% | 220_378del |
3 | human | 11328 | FKBP9 | FKBP prolyl isomerase 9 | XM_011515115.3 | 61.8% | 60.8% | (many diffs) |
4 | human | 11328 | FKBP9 | FKBP prolyl isomerase 9 | NM_001284343.1 | 59.2% | 58.9% | 0_1ins694;5delC;6_7insGAT |
5 | human | 360132 | FKBP9P1 | FKBP prolyl isomerase 9 pse... | NR_003949.1 | 25.3% | (many diffs) | |
6 | human | 360132 | FKBP9P1 | FKBP prolyl isomerase 9 pse... | NR_027340.1 | 16.7% | (many diffs) | |
7 | mouse | 27055 | Fkbp9 | FK506 binding protein 9 | NM_012056.2 | 88% | 92.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1779
- ORF length:
- 1710
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgttccgg ggctggaggc ccccgccgcc accgctgctc ctgctgctgc 121 tctgggtgac cgggcaggca gcgcccgtgg cgggcctggg ctccgacgcg gagctgcaga 181 tcgagcggcg cttcgtgccc gacgagtgcc cgcgcaccgt gcgcagcggc gacttcgtgc 241 gctaccacta cgtggggacg ttccccgacg gccagaagtt cgactccagc tatgacagag 301 actccacttt caatgtgttt gtgggaaaag gacagctgat cacagggatg gaccaggctc 361 ttgttgggat gtgcgtaaac gagagacgtt tcgtgaagat tcccccaaag cttgcctacg 421 gaaatgaagg agtttctggt gtgatccccc ccaattcagt gcttcatttt gatgtacttc 481 tgatggatat ttggaattct gaagaccagg ttcagattca cacctatttc aagcccccga 541 gttgccctcg gaccatccag gtgtctgatt ttgtgaggta ccactacaac gggacgttcc 601 tggacggaac tctgtttgat tcgagtcaca atcgcatgaa aacatatgac acgtatgtgg 661 gaattggctg gctgattcct ggaatggata aagggctgct ggggatgtgt gtgggtgaga 721 agcgcatcat caccattcct ccttttctgg cctatggaga ggatggagat gggaaagaca 781 ttcccggtca ggcatctctg gtgtttgatg ttgcattatt ggacctccat aaccccaagg 841 acagcatttc cattgagaac aaggtagtac ctgaaaactg tgagcggata agtcaaagtg 901 gggactttct caggtatcat tacaatggca cgcttctgga tggcaccctc tttgattcca 961 gctactctcg gaaccgcacg tttgacacgt acattgggca gggctacgtg attcctggga 1021 tggatgaagg tctacttggt gtttgcattg gagaaaagcg aaggattgtg gtcccgcctc 1081 acctggggta tggagaggaa ggaagaggga atatccccgg ctcggctgtg ctggtgtttg 1141 acatccatgt gatcgacttc cacaaccctt cggactccat cagcatcacc tcccactaca 1201 aaccccctga ctgctcagtg ctgagtaaga agggagatta cctcaaatat cactacaatg 1261 cctcacttct ggatgggacc ctgctggact ccacgtggaa tttaggcaaa acttacaata 1321 ttgttctggg atctgggcaa gttgtgttgg ggatggacat gggtctcaga gagatgtgcg 1381 ttggcgagaa acggacagtg atcattccgc ctcacctggg ctatggggaa gctggcgtgg 1441 atggagaagt gcccggcagt gccgtattag tgtttgacat tgagctgctg gagctggtgg 1501 ctggccttcc tgaggggtac atgttcatat ggaatggtga ggtgtCACCC AACCTCTTTG 1561 AAGAAATTGA CAAGGATGGC AACGGAGAAG TCCTCCTGGA AGAGTTCTCA GAGTACATTC 1621 ACGCCCAGGT GGCATCTGGC AAAGGGAAAC TCGCTCCTGG CTTTGATGCT GAGCTGATTG 1681 TGAAGAATAT GTTCACCAAC CAGGACCGGA ATGGAGATGG GAAGGTCACA GCCGAGGAAT 1741 TTAAACTCAA AGACCAGGAA GCCAAACACG ATGAACTCTT GCCAACTTTC TTGTACAAAG 1801 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1861 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1921 ACGAAAATTT CCCTTGACGT ACATGCCTAC GCGTTAAGTC gacaatcaac ctctggatta 1981 caaaatttgt gaaagatt