Transcript: Human XM_011515152.2

PREDICTED: Homo sapiens anterior gradient 3, protein disulphide isomerase family member (AGR3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGR3 (155465)
Length:
721
CDS:
66..518

Additional Resources:

NCBI RefSeq record:
XM_011515152.2
NBCI Gene record:
AGR3 (155465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146317 CATGTTTGTAGACCCTTCTTT pLKO.1 422 CDS 100% 5.625 7.875 N AGR3 n/a
2 TRCN0000148127 GAGGATTGTCAATACTCTCAA pLKO.1 270 CDS 100% 4.950 6.930 N AGR3 n/a
3 TRCN0000371286 CAACCTTGCCATTGCAATAAA pLKO_005 119 CDS 100% 15.000 10.500 N AGR3 n/a
4 TRCN0000371239 AGAAGCCATTAATGGTTATTC pLKO_005 241 CDS 100% 13.200 9.240 N AGR3 n/a
5 TRCN0000371238 TGACATCACTTGGGTACAAAC pLKO_005 185 CDS 100% 10.800 7.560 N AGR3 n/a
6 TRCN0000149243 GATGACATCACTTGGGTACAA pLKO.1 183 CDS 100% 4.950 3.465 N AGR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05089 pDONR223 100% 90.3% 90.3% None 450_451ins48 n/a
2 ccsbBroad304_05089 pLX_304 0% 90.3% 90.3% V5 450_451ins48 n/a
3 TRCN0000492163 CTTACAATGATTATCCAATAAACT pLX_317 73.1% 90.3% 90.3% V5 450_451ins48 n/a
Download CSV