Transcript: Human XM_011515201.2

PREDICTED: Homo sapiens solute carrier family 29 member 4 (SLC29A4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC29A4 (222962)
Length:
2895
CDS:
182..1774

Additional Resources:

NCBI RefSeq record:
XM_011515201.2
NBCI Gene record:
SLC29A4 (222962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043700 AGTGCAGCAATCCAGCTTCTA pLKO.1 724 CDS 100% 4.950 6.930 N SLC29A4 n/a
2 TRCN0000420801 GACCTCCATCGTGTTTGACAT pLKO_005 484 CDS 100% 4.950 3.960 N SLC29A4 n/a
3 TRCN0000043698 GCTGCCATACAACAGCTTCAT pLKO.1 427 CDS 100% 4.950 3.465 N SLC29A4 n/a
4 TRCN0000443399 AGCTTCACCTTCGACAGTCAC pLKO_005 254 CDS 100% 4.050 2.835 N SLC29A4 n/a
5 TRCN0000444213 TGTCCTCCTGAACAACGTCCT pLKO_005 538 CDS 100% 2.160 1.512 N SLC29A4 n/a
6 TRCN0000043701 CCTGTCAGACTTCGTGGGCAA pLKO.1 1369 CDS 100% 0.720 0.504 N SLC29A4 n/a
7 TRCN0000079757 GTGTTCAACCTGTCAGACTTT pLKO.1 1361 CDS 100% 4.950 3.465 N Slc29a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489419 ATGACAAGACAACCAGGTTGATTC pLX_317 21.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_13440 pDONR223 100% 97.2% 91.7% None 413_449del;542_546delCAGTG;978T>C n/a
3 ccsbBroad304_13440 pLX_304 0% 97.2% 91.7% V5 413_449del;542_546delCAGTG;978T>C n/a
4 TRCN0000469666 CTCTACGCATCGAGTATTAGCCCC pLX_317 17.4% 97.2% 91.7% V5 413_449del;542_546delCAGTG;978T>C n/a
Download CSV