Transcript: Human XM_011515393.2

PREDICTED: Homo sapiens integrin subunit beta 8 (ITGB8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGB8 (3696)
Length:
8575
CDS:
533..2818

Additional Resources:

NCBI RefSeq record:
XM_011515393.2
NBCI Gene record:
ITGB8 (3696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434564 ATTCCGTTGGAAACGATTTAT pLKO_005 1008 CDS 100% 15.000 12.000 N ITGB8 n/a
2 TRCN0000057766 CCGTGACTTTCGTCTTGGATT pLKO.1 1051 CDS 100% 4.950 3.960 N ITGB8 n/a
3 TRCN0000413303 CAATGCAGTGACTACAATTTA pLKO_005 1136 CDS 100% 15.000 10.500 N ITGB8 n/a
4 TRCN0000412408 TCAGCATCAATGCACAATAAT pLKO_005 974 CDS 100% 15.000 10.500 N ITGB8 n/a
5 TRCN0000431442 TGCTTAAAGTCCTGATCATTA pLKO_005 2601 CDS 100% 13.200 9.240 N ITGB8 n/a
6 TRCN0000445088 TTGCAGTGGTCGAGGAGTTTG pLKO_005 2065 CDS 100% 10.800 7.560 N ITGB8 n/a
7 TRCN0000057765 CCCAGCACTGTGTCAATTCAA pLKO.1 2277 CDS 100% 5.625 3.938 N ITGB8 n/a
8 TRCN0000057767 CGACCAAACTTCAGAATGTTT pLKO.1 2518 CDS 100% 5.625 3.938 N ITGB8 n/a
9 TRCN0000057764 CGAGCAATGATGAAGTTCTTT pLKO.1 1776 CDS 100% 5.625 3.938 N ITGB8 n/a
10 TRCN0000057763 GCTCAGTTGATTCAATAGAAT pLKO.1 789 CDS 100% 5.625 3.938 N ITGB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10927 pDONR223 100% 52.7% 50.8% None (many diffs) n/a
2 ccsbBroad304_10927 pLX_304 0% 52.7% 50.8% V5 (many diffs) n/a
3 TRCN0000492260 CACAAAAAGGGCTAGGCCAAGATA pLX_317 35.4% 52.7% 50.8% V5 (many diffs) n/a
Download CSV