Transcript: Human XM_011515739.2

PREDICTED: Homo sapiens zinc finger HIT-type containing 1 (ZNHIT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNHIT1 (10467)
Length:
921
CDS:
179..688

Additional Resources:

NCBI RefSeq record:
XM_011515739.2
NBCI Gene record:
ZNHIT1 (10467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197290 GATGCGGACACTGGAAAGAAA pLKO.1 404 CDS 100% 5.625 3.938 N ZNHIT1 n/a
2 TRCN0000323206 GATGCGGACACTGGAAAGAAA pLKO_005 404 CDS 100% 5.625 3.938 N ZNHIT1 n/a
3 TRCN0000163169 GAGACTGCCTCAGTTTGATGA pLKO.1 382 CDS 100% 4.950 3.465 N ZNHIT1 n/a
4 TRCN0000323135 GAGACTGCCTCAGTTTGATGA pLKO_005 382 CDS 100% 4.950 3.465 N ZNHIT1 n/a
5 TRCN0000161101 GAATGACAACTTCCAGGATGA pLKO.1 331 CDS 100% 4.050 2.835 N ZNHIT1 n/a
6 TRCN0000164544 CCTGGAGAATGACAACTTCCA pLKO.1 325 CDS 100% 2.640 1.848 N ZNHIT1 n/a
7 TRCN0000161467 GAGAATGACAACTTCCAGGAT pLKO.1 329 CDS 100% 2.640 1.848 N ZNHIT1 n/a
8 TRCN0000186657 GCCTTCAGAAAGACAGAATTT pLKO.1 732 3UTR 100% 13.200 7.920 N ZNHIT1 n/a
9 TRCN0000323137 GCCTTCAGAAAGACAGAATTT pLKO_005 732 3UTR 100% 13.200 7.920 N ZNHIT1 n/a
10 TRCN0000323208 TGTTGGAGGAGCAGAACTTGA pLKO_005 483 CDS 100% 4.950 2.970 N ZNHIT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02444 pDONR223 100% 89.2% 86.9% None (many diffs) n/a
2 ccsbBroad304_02444 pLX_304 0% 89.2% 86.9% V5 (many diffs) n/a
3 TRCN0000470999 GGGTACAAGGTCCCCCCTGGCCTT pLX_317 92.5% 89.2% 86.9% V5 (many diffs) n/a
Download CSV