Transcript: Human XM_011515788.2

PREDICTED: Homo sapiens tripartite motif containing 50 (TRIM50), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM50 (135892)
Length:
1600
CDS:
379..1215

Additional Resources:

NCBI RefSeq record:
XM_011515788.2
NBCI Gene record:
TRIM50 (135892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515788.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007784 CCACAAGTTCATCCGGAAGTT pLKO.1 462 CDS 100% 4.950 3.465 N TRIM50 n/a
2 TRCN0000428149 AGGGTGTATTTGTAAACTTCG pLKO_005 1395 3UTR 100% 4.050 2.835 N TRIM50 n/a
3 TRCN0000007783 CGTCACTGTTTAGGAAGGTCT pLKO.1 1306 3UTR 100% 2.640 1.848 N TRIM50 n/a
4 TRCN0000007786 GCAGGGCGAACTCACCTTCTT pLKO.1 1014 CDS 100% 1.650 1.155 N TRIM50 n/a
5 TRCN0000435476 TGTGTCCCTGGAACATGTAAT pLKO_005 1336 3UTR 100% 13.200 7.920 N TRIM50 n/a
6 TRCN0000221033 CTCATCGCCAAACTGGTGAAA pLKO.1 186 5UTR 100% 4.950 2.475 Y TRIM74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515788.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09564 pDONR223 100% 57% 57% None 0_1ins627 n/a
2 ccsbBroad304_09564 pLX_304 0% 57% 57% V5 0_1ins627 n/a
3 TRCN0000476413 GCAGATCCGACACGTTAAGGCGTT pLX_317 20.6% 57% 57% V5 0_1ins627 n/a
Download CSV