Transcript: Human XM_011516274.3

PREDICTED: Homo sapiens patatin like phospholipase domain containing 8 (PNPLA8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA8 (50640)
Length:
3983
CDS:
764..3196

Additional Resources:

NCBI RefSeq record:
XM_011516274.3
NBCI Gene record:
PNPLA8 (50640)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365718 GGCATTAGTTCAGGCATTAAG pLKO_005 1939 CDS 100% 13.200 18.480 N PNPLA8 n/a
2 TRCN0000055816 CCATAGTAAATAGAGGGATAA pLKO.1 2547 CDS 100% 10.800 15.120 N PNPLA8 n/a
3 TRCN0000055813 CGAACAAGAAACCGAAAGCTA pLKO.1 3506 3UTR 100% 3.000 4.200 N PNPLA8 n/a
4 TRCN0000370939 ACGGAAGGTGTACAAGCTTTA pLKO_005 1730 CDS 100% 10.800 8.640 N PNPLA8 n/a
5 TRCN0000055814 CGGGCATTAGTTCAGGCATTA pLKO.1 1937 CDS 100% 10.800 8.640 N PNPLA8 n/a
6 TRCN0000365717 CATTTGTATGTCCCGTATTAA pLKO_005 1141 CDS 100% 15.000 10.500 N PNPLA8 n/a
7 TRCN0000055815 CCAGGCTACTTTGCAGAATAT pLKO.1 2681 CDS 100% 13.200 9.240 N PNPLA8 n/a
8 TRCN0000377644 CCTTACTGTGCTAGTAGATTT pLKO_005 3430 3UTR 100% 13.200 9.240 N PNPLA8 n/a
9 TRCN0000370998 GCCGTTAGAGTGCATAGTATC pLKO_005 2797 CDS 100% 10.800 7.560 N PNPLA8 n/a
10 TRCN0000376669 TTATCGCAAGGGTGAGTATTG pLKO_005 1905 CDS 100% 10.800 7.560 N PNPLA8 n/a
11 TRCN0000055817 CCTAAGCATTACTGGAGGATA pLKO.1 950 CDS 100% 4.950 3.465 N PNPLA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14130 pDONR223 100% 94.7% 94.3% None (many diffs) n/a
2 ccsbBroad304_14130 pLX_304 0% 94.7% 94.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466476 AGGGGTTTGCTCTTCAAAACCCAT pLX_317 17.6% 94.7% 94.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV