Transcript: Human XM_011516316.1

PREDICTED: Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (PIK3CG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3CG (5294)
Length:
3325
CDS:
144..3179

Additional Resources:

NCBI RefSeq record:
XM_011516316.1
NBCI Gene record:
PIK3CG (5294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430313 TACGAATCATGGAGTCTATTT pLKO_005 2686 CDS 100% 13.200 18.480 N PIK3CG n/a
2 TRCN0000033282 CGGGCACATTCTTGGGAATTA pLKO.1 3038 CDS 100% 13.200 10.560 N PIK3CG n/a
3 TRCN0000232402 GACGTCAGTTCCCAAGTTATT pLKO_005 2415 CDS 100% 13.200 10.560 N Pik3cg n/a
4 TRCN0000419619 AGCATATCCTAAGCTATTTAG pLKO_005 1904 CDS 100% 13.200 9.240 N PIK3CG n/a
5 TRCN0000361703 CAAGATCAGAGGCATTGATAT pLKO_005 1232 CDS 100% 13.200 9.240 N Pik3cg n/a
6 TRCN0000033281 GCCCTATCAAATGAAACAATT pLKO.1 2607 CDS 100% 13.200 9.240 N PIK3CG n/a
7 TRCN0000421875 GTGAAAGACGCCACGACAATT pLKO_005 2787 CDS 100% 13.200 9.240 N PIK3CG n/a
8 TRCN0000199330 CTCCAGATCTACTGCGGTAAA pLKO.1 1434 CDS 100% 10.800 7.560 N PIK3CG n/a
9 TRCN0000196449 GACTGAATCTTTGGATCTATG pLKO.1 2711 CDS 100% 10.800 7.560 N PIK3CG n/a
10 TRCN0000033279 GCAACCTTTGTTCTTGGAATA pLKO.1 2955 CDS 100% 10.800 7.560 N PIK3CG n/a
11 TRCN0000033280 GCAGAGCTTCTTCACCAAGAT pLKO.1 878 CDS 100% 4.950 3.465 N PIK3CG n/a
12 TRCN0000033283 CCTGTGGAAGAAGATTGCCAA pLKO.1 773 CDS 100% 2.640 1.584 N PIK3CG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14762 pDONR223 0% 91.5% 91.6% None (many diffs) n/a
2 ccsbBroad304_14762 pLX_304 0% 91.5% 91.6% V5 (many diffs) n/a
3 TRCN0000480523 TACTATCAGTCTAGTTATCATTTA pLX_317 12.4% 91.5% 91.6% V5 (many diffs) n/a
4 ccsbBroadEn_06727 pDONR223 100% 91.5% 91.5% None (many diffs) n/a
5 ccsbBroad304_06727 pLX_304 0% 91.5% 91.5% V5 (many diffs) n/a
6 TRCN0000481299 CCCACTCTGTAACCGTTGCGGCCC pLX_317 13.1% 91.5% 91.5% V5 (many diffs) n/a
Download CSV