Transcript: Human XM_011516369.2

PREDICTED: Homo sapiens WD repeat domain 60 (WDR60), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR60 (55112)
Length:
3627
CDS:
143..3214

Additional Resources:

NCBI RefSeq record:
XM_011516369.2
NBCI Gene record:
WDR60 (55112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134998 CGCAGGTTCAATAAGTGATTT pLKO.1 2476 CDS 100% 13.200 9.240 N WDR60 n/a
2 TRCN0000138078 GCACAGACATGGGTCTCATAA pLKO.1 2649 CDS 100% 13.200 9.240 N WDR60 n/a
3 TRCN0000138027 GCCATGGCACAAGACAAGATT pLKO.1 2670 CDS 100% 5.625 3.938 N WDR60 n/a
4 TRCN0000136934 CGACACATCCAACATCTACAT pLKO.1 2935 CDS 100% 4.950 3.465 N WDR60 n/a
5 TRCN0000191802 GAGAAAGAAGATACCGAGAAA pLKO.1 552 CDS 100% 4.950 3.465 N Wdr60 n/a
6 TRCN0000138760 GCGTTTCTGTAATGACCCAGA pLKO.1 3235 3UTR 100% 2.160 1.512 N WDR60 n/a
7 TRCN0000134759 GCATATGTTCAGTGTAACGAA pLKO.1 1604 CDS 100% 0.000 0.000 N WDR60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08472 pDONR223 100% 95.3% 95.2% None (many diffs) n/a
2 ccsbBroad304_08472 pLX_304 0% 95.3% 95.2% V5 (many diffs) n/a
3 TRCN0000470585 ACATAACCACTAGCGAACTACTCG pLX_317 13.4% 95.3% 95.2% V5 (many diffs) n/a
Download CSV