Transcript: Human XM_011516372.3

PREDICTED: Homo sapiens tRNA-yW synthesizing protein 1 homolog (TYW1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TYW1 (55253)
Length:
5535
CDS:
150..2234

Additional Resources:

NCBI RefSeq record:
XM_011516372.3
NBCI Gene record:
TYW1 (55253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296442 AGAGATTCCTTGACAGTTTAA pLKO_005 1810 CDS 100% 13.200 9.240 N TYW1 n/a
2 TRCN0000296500 CCCTTACTAAACAAGGTTATC pLKO_005 1237 CDS 100% 10.800 7.560 N TYW1 n/a
3 TRCN0000296499 TTTGATGACAAATGGTTATGT pLKO_005 329 CDS 100% 5.625 3.938 N TYW1 n/a
4 TRCN0000056652 CCTTCAAGAGAAAGACATCTT pLKO.1 353 CDS 100% 4.950 3.465 N TYW1 n/a
5 TRCN0000056650 CAGGGCAAGAACTTACAGGAA pLKO.1 282 CDS 100% 2.640 1.848 N TYW1 n/a
6 TRCN0000296441 AGCAGGATGAATTGCATCATA pLKO_005 979 CDS 100% 5.625 3.375 N TYW1 n/a
7 TRCN0000337099 AGCTTGGCGTGTGCTAATAAA pLKO_005 1386 CDS 100% 15.000 7.500 Y TYW1B n/a
8 TRCN0000337169 AGGACCATCAGAGCCTAAATT pLKO_005 1057 CDS 100% 15.000 7.500 Y TYW1B n/a
9 TRCN0000337173 CTCCGAGAAGCCCTTACTAAA pLKO_005 1227 CDS 100% 13.200 6.600 Y TYW1B n/a
10 TRCN0000056648 CCTCCTGATAGCACACAGAAA pLKO.1 2105 CDS 100% 4.950 2.475 Y TYW1 n/a
11 TRCN0000290054 CCTCCTGATAGCACACAGAAA pLKO_005 2105 CDS 100% 4.950 2.475 Y TYW1 n/a
12 TRCN0000056651 CCCGAATATGAAATTGCATGT pLKO.1 2064 CDS 100% 4.050 2.025 Y TYW1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3258 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000136945 CCATGATTCAATTACCTCCCA pLKO.1 4152 3UTR 100% 0.660 0.330 Y DISC1 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3258 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05678 pDONR223 100% 81% 78.6% None (many diffs) n/a
2 ccsbBroad304_05678 pLX_304 0% 81% 78.6% V5 (many diffs) n/a
3 TRCN0000474336 TGCAGATAATATTTTCCCCCAGTC pLX_317 20.1% 81% 78.6% V5 (many diffs) n/a
Download CSV