Transcript: Human XM_011516461.3

PREDICTED: Homo sapiens leucine rich repeat containing 4 (LRRC4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC4 (64101)
Length:
3847
CDS:
278..2239

Additional Resources:

NCBI RefSeq record:
XM_011516461.3
NBCI Gene record:
LRRC4 (64101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516461.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160001 CCTGACAGAATTGCTTAGAAA pLKO.1 2933 3UTR 100% 5.625 7.875 N LRRC4 n/a
2 TRCN0000159532 CCACTATCTCTGAACCTTATA pLKO.1 2172 CDS 100% 13.200 10.560 N LRRC4 n/a
3 TRCN0000161987 GTATATCTCTGAGGGAGCTTT pLKO.1 832 CDS 100% 4.950 3.960 N LRRC4 n/a
4 TRCN0000158689 GCTGATTCATTAGGGATTATT pLKO.1 3346 3UTR 100% 15.000 10.500 N LRRC4 n/a
5 TRCN0000161528 GCTCAAGAAGCTGGAGTATAT pLKO.1 817 CDS 100% 13.200 9.240 N LRRC4 n/a
6 TRCN0000159202 GAGAGTATATACCCACCAATT pLKO.1 1224 CDS 100% 10.800 7.560 N LRRC4 n/a
7 TRCN0000161701 GCACACAAAGACAGCAACTTT pLKO.1 2278 3UTR 100% 5.625 3.938 N LRRC4 n/a
8 TRCN0000160733 CGCCATGTTGATTGTCTTCTA pLKO.1 1900 CDS 100% 4.950 3.465 N LRRC4 n/a
9 TRCN0000161850 GCTTTCACATTGCACCAGATT pLKO.1 2996 3UTR 100% 4.950 3.465 N LRRC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516461.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03923 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03923 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469626 ACAGCAATTCGCGGCATTTTCGAA pLX_317 20.9% 100% 100% V5 n/a
Download CSV