Transcript: Human XM_011516688.3

PREDICTED: Homo sapiens zinc finger CCCH-type containing, antiviral 1 like (ZC3HAV1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3HAV1L (92092)
Length:
3010
CDS:
455..1420

Additional Resources:

NCBI RefSeq record:
XM_011516688.3
NBCI Gene record:
ZC3HAV1L (92092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149040 GCTTATCCATGCTGCATCTTT pLKO.1 1090 CDS 100% 5.625 7.875 N ZC3HAV1L n/a
2 TRCN0000129759 CCTCAAGGATAAATGCAACAA pLKO.1 1003 CDS 100% 4.950 3.960 N ZC3HAV1L n/a
3 TRCN0000435352 AGGACCAAGGACTGAATATTC pLKO_005 1122 CDS 100% 13.200 9.240 N ZC3HAV1L n/a
4 TRCN0000149479 GCAACAAGTTTCATGTGTGCA pLKO.1 1017 CDS 100% 2.640 1.848 N ZC3HAV1L n/a
5 TRCN0000152482 CTACTGCAACCTCAAGGATTA pLKO.1 994 CDS 100% 10.800 5.400 Y MARVELD1 n/a
6 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 1372 CDS 100% 4.950 2.475 Y CCNJL n/a
7 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1408 CDS 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 6.2% 4.7% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 6.2% 4.7% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 6.2% 4.7% V5 (many diffs) n/a
Download CSV