Transcript: Human XM_011517163.3

PREDICTED: Homo sapiens gasdermin C (GSDMC), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSDMC (56169)
Length:
1682
CDS:
109..1377

Additional Resources:

NCBI RefSeq record:
XM_011517163.3
NBCI Gene record:
GSDMC (56169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129367 GCTGTACGATAGCAGTAGTGT pLKO.1 357 CDS 100% 3.000 4.200 N GSDMC n/a
2 TRCN0000130808 GAGTAGAGACAGTAATGGGTA pLKO.1 1489 3UTR 100% 2.640 2.112 N GSDMC n/a
3 TRCN0000130037 GCCATCCTAAAGAAACTTCAA pLKO.1 976 CDS 100% 4.950 3.465 N GSDMC n/a
4 TRCN0000131060 CCCAGTAGGAAGAATAGAGGA pLKO.1 759 CDS 100% 2.640 1.848 N GSDMC n/a
5 TRCN0000130940 CCTGGAGCCAAACTTCAGATA pLKO.1 1149 CDS 100% 4.950 2.970 N GSDMC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08634 pDONR223 100% 82.9% 82.8% None 0_1ins258;1166T>C;1242G>A n/a
2 ccsbBroad304_08634 pLX_304 0% 82.9% 82.8% V5 0_1ins258;1166T>C;1242G>A n/a
3 TRCN0000466551 ATCAAAGATACCAGTGTTATTCCC pLX_317 21.6% 82.9% 82.8% V5 0_1ins258;1166T>C;1242G>A n/a
4 ccsbBroadEn_15922 pDONR223 0% 82.8% 82.8% None (many diffs) n/a
5 ccsbBroad304_15922 pLX_304 0% 82.8% 82.8% V5 (many diffs) n/a
6 TRCN0000473727 ATTAACACGAAATTGTAACCAAGC pLX_317 27% 82.8% 82.8% V5 (many diffs) n/a
Download CSV