Transcript: Human XM_011517168.2

PREDICTED: Homo sapiens gasdermin C (GSDMC), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSDMC (56169)
Length:
1434
CDS:
547..1323

Additional Resources:

NCBI RefSeq record:
XM_011517168.2
NBCI Gene record:
GSDMC (56169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129367 GCTGTACGATAGCAGTAGTGT pLKO.1 1053 CDS 100% 3.000 4.200 N GSDMC n/a
2 TRCN0000128042 GCCACCAAATTACGTCAGTTT pLKO.1 634 CDS 100% 4.950 3.960 N GSDMC n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 458 5UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 458 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08634 pDONR223 100% 49.3% 47.6% None (many diffs) n/a
2 ccsbBroad304_08634 pLX_304 0% 49.3% 47.6% V5 (many diffs) n/a
3 TRCN0000466551 ATCAAAGATACCAGTGTTATTCCC pLX_317 21.6% 49.3% 47.6% V5 (many diffs) n/a
4 ccsbBroadEn_15922 pDONR223 0% 49.3% 47.8% None (many diffs) n/a
5 ccsbBroad304_15922 pLX_304 0% 49.3% 47.8% V5 (many diffs) n/a
6 TRCN0000473727 ATTAACACGAAATTGTAACCAAGC pLX_317 27% 49.3% 47.8% V5 (many diffs) n/a
Download CSV