Transcript: Human XM_011517225.2

PREDICTED: Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 1 (ST3GAL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST3GAL1 (6482)
Length:
7688
CDS:
1750..2772

Additional Resources:

NCBI RefSeq record:
XM_011517225.2
NBCI Gene record:
ST3GAL1 (6482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231843 AGAGACTTGAGTGGCGATTAC pLKO_005 3155 3UTR 100% 10.800 8.640 N ST3GAL1 n/a
2 TRCN0000231842 ACCTTGGCCTCCATCAATAAA pLKO_005 2728 CDS 100% 15.000 10.500 N ST3GAL1 n/a
3 TRCN0000035552 GCGGGAGAAGAAGCCCAATAA pLKO.1 2064 CDS 100% 13.200 9.240 N ST3GAL1 n/a
4 TRCN0000231839 GCGGGAGAAGAAGCCCAATAA pLKO_005 2064 CDS 100% 13.200 9.240 N ST3GAL1 n/a
5 TRCN0000231841 GATGCAGACTTTGAGTCTAAC pLKO_005 2698 CDS 100% 10.800 7.560 N ST3GAL1 n/a
6 TRCN0000035550 CCTGCAAAGATCAGAGTGAAA pLKO.1 2449 CDS 100% 4.950 3.465 N ST3GAL1 n/a
7 TRCN0000035549 GCCTTCATCAAGTATGTCTTT pLKO.1 2497 CDS 100% 4.950 3.465 N ST3GAL1 n/a
8 TRCN0000035553 CCTGAACTACTCCCACACCAT pLKO.1 1824 CDS 100% 2.640 1.848 N ST3GAL1 n/a
9 TRCN0000035551 GCTGGGAGATAATGTCAGCAT pLKO.1 2340 CDS 100% 2.640 1.848 N ST3GAL1 n/a
10 TRCN0000231840 AGATAGACAGTCACGACTTTG pLKO_005 2225 CDS 100% 10.800 6.480 N ST3GAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06949 pDONR223 100% 99.9% 100% None 261C>T n/a
2 ccsbBroad304_06949 pLX_304 0% 99.9% 100% V5 261C>T n/a
3 TRCN0000473277 AGACCCATACACAAGGTAACGCGA pLX_317 43.8% 99.9% 100% V5 261C>T n/a
Download CSV