Transcript: Human XM_011517355.2

PREDICTED: Homo sapiens Jrk helix-turn-helix protein (JRK), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JRK (8629)
Length:
2466
CDS:
515..2122

Additional Resources:

NCBI RefSeq record:
XM_011517355.2
NBCI Gene record:
JRK (8629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219822 TCCGATTGGTTCCATCATATC pLKO.1 1316 CDS 100% 10.800 15.120 N JRK n/a
2 TRCN0000219821 AGGGTGGCTTTGGCGCTTTAA pLKO.1 913 CDS 100% 13.200 9.240 N JRK n/a
3 TRCN0000148274 CAACATGAACGATGCCATATT pLKO.1 1585 CDS 100% 13.200 9.240 N JRK n/a
4 TRCN0000436407 CACTTCAGAACCATAGGTTTG pLKO_005 1358 CDS 100% 6.000 4.200 N JRK n/a
5 TRCN0000180241 CCACAACAAGTCCTTTGCACA pLKO.1 1744 CDS 100% 2.640 1.848 N JRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07276 pDONR223 100% 93.7% 92.7% None (many diffs) n/a
2 ccsbBroad304_07276 pLX_304 0% 93.7% 92.7% V5 (many diffs) n/a
3 TRCN0000481293 TCATCTAACCTCTCCGACCAATTT pLX_317 24.7% 93.7% 92.7% V5 (many diffs) n/a
Download CSV