Transcript: Human XM_011517620.2

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C5 beta (DNAJC5B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC5B (85479)
Length:
970
CDS:
285..827

Additional Resources:

NCBI RefSeq record:
XM_011517620.2
NBCI Gene record:
DNAJC5B (85479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152396 GCTGCTACTGAGAAGTTTAAA pLKO.1 450 CDS 100% 15.000 10.500 N DNAJC5B n/a
2 TRCN0000152227 CGAAATTCTTGGTCTGCATAA pLKO.1 347 CDS 100% 10.800 7.560 N DNAJC5B n/a
3 TRCN0000150586 GAGAAGCATATACGACAAGTA pLKO.1 512 CDS 100% 4.950 3.465 N DNAJC5B n/a
4 TRCN0000151789 CGACATTTCAAAGAGAAGCAT pLKO.1 500 CDS 100% 3.000 2.100 N DNAJC5B n/a
5 TRCN0000155489 GCAGATCAAGTCTGACATGGA pLKO.1 764 CDS 100% 2.640 1.848 N DNAJC5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04486 pDONR223 100% 86.9% 85.9% None (many diffs) n/a
2 ccsbBroad304_04486 pLX_304 0% 86.9% 85.9% V5 (many diffs) n/a
3 TRCN0000472112 GCCAGTCCGACTAGCATGACGTAC pLX_317 77.4% 86.9% 85.9% V5 (many diffs) n/a
Download CSV