Transcript: Human XM_011517785.2

PREDICTED: Homo sapiens ELAV like RNA binding protein 2 (ELAVL2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELAVL2 (1993)
Length:
3577
CDS:
37..1119

Additional Resources:

NCBI RefSeq record:
XM_011517785.2
NBCI Gene record:
ELAVL2 (1993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021935 CGCATTATTACTTCTCGTATT pLKO.1 484 CDS 100% 10.800 15.120 N ELAVL2 n/a
2 TRCN0000319410 GGTGTAGGGTTTATTCGATTT pLKO_005 535 CDS 100% 10.800 15.120 N Elavl2 n/a
3 TRCN0000429130 TTCGATTTGACAAGCGAATTG pLKO_005 548 CDS 100% 10.800 15.120 N ELAVL2 n/a
4 TRCN0000021934 CCGTGACTTTAACACCAATAA pLKO.1 963 CDS 100% 13.200 9.240 N ELAVL2 n/a
5 TRCN0000319424 CTCTTGTCCTCAGTCCATTTA pLKO_005 1124 3UTR 100% 13.200 9.240 N Elavl2 n/a
6 TRCN0000421130 CTCTTGTCCTCAGTCCATTTA pLKO_005 1124 3UTR 100% 13.200 9.240 N ELAVL2 n/a
7 TRCN0000319495 GAAGCTATCAAAGGCCTAAAT pLKO_005 577 CDS 100% 13.200 9.240 N Elavl2 n/a
8 TRCN0000426674 GAAGCTATCAAAGGCCTAAAT pLKO_005 577 CDS 100% 13.200 9.240 N ELAVL2 n/a
9 TRCN0000419651 GTTGGACAATCTGCTCAATAT pLKO_005 750 CDS 100% 13.200 9.240 N ELAVL2 n/a
10 TRCN0000112022 GCAGGTCTCCTTTAAGACAAA pLKO.1 1080 CDS 100% 4.950 3.465 N Elavl2 n/a
11 TRCN0000317611 GCAGGTCTCCTTTAAGACAAA pLKO_005 1080 CDS 100% 4.950 3.465 N Elavl2 n/a
12 TRCN0000021937 GCTTCTATCAGAGATGCAAAT pLKO.1 394 CDS 100% 10.800 6.480 N ELAVL2 n/a
13 TRCN0000021936 GTCTCCTTTAAGACAAACAAA pLKO.1 1084 CDS 100% 5.625 3.375 N ELAVL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00495 pDONR223 100% 96.1% 96.1% None 712_753del n/a
2 ccsbBroad304_00495 pLX_304 0% 96.1% 96.1% V5 712_753del n/a
3 TRCN0000471175 GTAAAGATAGGACGGCTTGTGCTG pLX_317 38.6% 96.1% 96.1% V5 712_753del n/a
Download CSV