Transcript: Human XM_011517843.1

PREDICTED: Homo sapiens DDB1 and CUL4 associated factor 12 (DCAF12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAF12 (25853)
Length:
3494
CDS:
758..1531

Additional Resources:

NCBI RefSeq record:
XM_011517843.1
NBCI Gene record:
DCAF12 (25853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168140 CCTGTGAAGAGATCCTTAGTA pLKO.1 290 5UTR 100% 5.625 3.938 N DCAF12 n/a
2 TRCN0000168680 GCTGGCTGAATCATGATGAAA pLKO.1 1365 CDS 100% 5.625 3.938 N DCAF12 n/a
3 TRCN0000168231 CATGATGAAACCTGGAGGAAT pLKO.1 1376 CDS 100% 4.950 3.465 N DCAF12 n/a
4 TRCN0000173036 CCTCCCTTGAACTGTCTGTTT pLKO.1 2806 3UTR 100% 4.950 2.970 N DCAF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07953 pDONR223 100% 56.7% 56.7% None 0_1ins588 n/a
2 ccsbBroad304_07953 pLX_304 0% 56.7% 56.7% V5 0_1ins588 n/a
3 TRCN0000476003 TTATGAACTCCACTGCAACGATCG pLX_317 23.5% 56.7% 56.7% V5 0_1ins588 n/a
Download CSV