Transcript: Human XM_011518094.2

PREDICTED: Homo sapiens ribosome biogenesis protein BMS1 homolog (LOC101929959), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101929959 (101929959)
Length:
1010
CDS:
499..957

Additional Resources:

NCBI RefSeq record:
XM_011518094.2
NBCI Gene record:
LOC101929959 (101929959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168428 GAAGACCACAATGGAAGACAA pLKO.1 874 CDS 100% 4.950 2.475 Y BMS1P20 n/a
2 TRCN0000167923 CAATGGAAGACAAAGGCTTCT pLKO.1 882 CDS 100% 4.050 2.025 Y BMS1P20 n/a
3 TRCN0000172365 CGAAGACCACAATGGAAGACA pLKO.1 873 CDS 100% 3.000 1.500 Y BMS1P20 n/a
4 TRCN0000168108 CACAATGGAAGACAAAGGCTT pLKO.1 880 CDS 100% 2.640 1.320 Y BMS1P20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07487 pDONR223 100% 11.4% 11.1% None (many diffs) n/a
2 ccsbBroad304_07487 pLX_304 0% 11.4% 11.1% V5 (many diffs) n/a
3 TRCN0000480950 GACCCCTCCATCATAGCGCCCGAA pLX_317 10.1% 11.4% 11.1% V5 (many diffs) n/a
Download CSV