Transcript: Human XM_011518159.1

PREDICTED: Homo sapiens NADPH oxidase activator 1 (NOXA1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOXA1 (10811)
Length:
1651
CDS:
598..1605

Additional Resources:

NCBI RefSeq record:
XM_011518159.1
NBCI Gene record:
NOXA1 (10811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046079 TGATGCCAGGTCCCTAATCAT pLKO.1 843 CDS 100% 5.625 3.938 N NOXA1 n/a
2 TRCN0000434155 CACTTGGAGCCCGTGGATTTC pLKO_005 730 CDS 100% 3.600 2.520 N NOXA1 n/a
3 TRCN0000046081 GCCTGGGAGGTGCTACACAAT pLKO.1 514 5UTR 100% 1.650 1.155 N NOXA1 n/a
4 TRCN0000431565 AGAGACAGAGGTCGGTGCTGA pLKO_005 906 CDS 100% 0.880 0.616 N NOXA1 n/a
5 TRCN0000046080 CGTGACCAAGGACACCTGCAT pLKO.1 233 5UTR 100% 0.880 0.616 N NOXA1 n/a
6 TRCN0000046082 GTCCTGTGTGAAGAGCCCGAT pLKO.1 1435 CDS 100% 0.720 0.504 N NOXA1 n/a
7 TRCN0000046078 CTTGGGCAACTCAGTTACCTA pLKO.1 1204 CDS 100% 3.000 1.800 N NOXA1 n/a
8 TRCN0000437038 CAACTTCCAGCTGGCAAGGTT pLKO_005 284 5UTR 100% 3.000 2.100 N NOXA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02533 pDONR223 100% 69.3% 69.3% None 0_1ins444 n/a
2 ccsbBroad304_02533 pLX_304 0% 69.3% 69.3% V5 0_1ins444 n/a
3 TRCN0000470920 TATTGGTAGGCCATTATCAATCCC pLX_317 24.7% 69.3% 69.3% V5 0_1ins444 n/a
Download CSV