Transcript: Human XM_011518300.2

PREDICTED: Homo sapiens zinc finger protein 483 (ZNF483), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF483 (158399)
Length:
14270
CDS:
1473..3707

Additional Resources:

NCBI RefSeq record:
XM_011518300.2
NBCI Gene record:
ZNF483 (158399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017495 CCCGACTAGATGAATCAGCTT pLKO.1 2185 CDS 100% 2.640 3.696 N ZNF483 n/a
2 TRCN0000017496 CGAAGCTCAATCCTTGTAGAA pLKO.1 3576 CDS 100% 4.950 3.960 N ZNF483 n/a
3 TRCN0000017494 CGTCTGTGATTTATCATCAAA pLKO.1 3331 CDS 100% 5.625 3.938 N ZNF483 n/a
4 TRCN0000017493 CCAGCTAAAGTGGGTTGAATT pLKO.1 2132 CDS 100% 0.000 0.000 N ZNF483 n/a
5 TRCN0000017497 CCTTAAATAAAGATGAGGGAA pLKO.1 2746 CDS 100% 2.640 1.584 N ZNF483 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 3192 CDS 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 3192 CDS 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 3527 CDS 100% 13.200 6.600 Y Gm14305 n/a
9 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 3526 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13305 pDONR223 100% 32.6% 32.2% None (many diffs) n/a
2 TRCN0000471195 ACTAATGTCAGATACCACCTCCTC pLX_317 33.5% 32.6% 32.2% V5 (many diffs) n/a
Download CSV