Transcript: Human XM_011518583.2

PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIN1 (2902)
Length:
3986
CDS:
335..3013

Additional Resources:

NCBI RefSeq record:
XM_011518583.2
NBCI Gene record:
GRIN1 (2902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417869 ACAAGACGTGGGTTCGGTATC pLKO_005 2763 CDS 100% 6.000 8.400 N GRIN1 n/a
2 TRCN0000063368 CCTGACTATTCTGGTCAAGAA pLKO.1 2008 CDS 100% 4.950 6.930 N GRIN1 n/a
3 TRCN0000425861 TGCAAGTGGGCATCTACAATG pLKO_005 1482 CDS 100% 10.800 7.560 N GRIN1 n/a
4 TRCN0000063369 CCCTAATGACAGGAAGATCAT pLKO.1 1516 CDS 100% 4.950 3.465 N GRIN1 n/a
5 TRCN0000063371 CGCCAACTACAGCATCATGAA pLKO.1 1441 CDS 100% 4.950 3.465 N GRIN1 n/a
6 TRCN0000063372 GTTTGAGATGATGCGTGTCTA pLKO.1 787 CDS 100% 4.950 3.465 N GRIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492101 CATCCTGCCAAACATTACTGGTCT pLX_317 7.9% 95.2% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487776 ACGTTGCACTGGCGGACTCGCCTT pLX_317 11.2% 90.7% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV