Transcript: Human XM_011518644.3

PREDICTED: Homo sapiens ERCC excision repair 6 like 2 (ERCC6L2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERCC6L2 (375748)
Length:
5647
CDS:
1016..4807

Additional Resources:

NCBI RefSeq record:
XM_011518644.3
NBCI Gene record:
ERCC6L2 (375748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018041 CGGTGCCAATGTTGTTGTATT pLKO.1 1933 CDS 100% 13.200 18.480 N ERCC6L2 n/a
2 TRCN0000167269 CAGTCGTATGAATCAATGGAT pLKO.1 3461 CDS 100% 3.000 4.200 N ERCC6L2 n/a
3 TRCN0000018042 GCGCACCAAGACTCTTATCAA pLKO.1 1264 CDS 100% 5.625 4.500 N ERCC6L2 n/a
4 TRCN0000167413 GAGCTGTGATTACTACCATTA pLKO.1 5445 3UTR 100% 10.800 7.560 N ERCC6L2 n/a
5 TRCN0000167155 CCACCTTCATAATTGGAGAAA pLKO.1 3789 CDS 100% 4.950 3.465 N ERCC6L2 n/a
6 TRCN0000018038 CCGGTTTCTTTATGGACACTA pLKO.1 741 5UTR 100% 4.950 3.465 N ERCC6L2 n/a
7 TRCN0000018040 CCTCTTAAACAGCTTCAAGAA pLKO.1 541 5UTR 100% 4.950 3.465 N ERCC6L2 n/a
8 TRCN0000018039 GCTGTCTATCAAACAGTGTTA pLKO.1 1346 CDS 100% 4.950 3.465 N ERCC6L2 n/a
9 TRCN0000168360 GCTGTCAGATTCTGAAACCTT pLKO.1 4075 CDS 100% 3.000 2.100 N ERCC6L2 n/a
10 TRCN0000168118 GCTTCTCAATATCCAGAGGTA pLKO.1 3944 CDS 100% 2.640 1.848 N ERCC6L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14486 pDONR223 100% 36.3% 36.3% None 1_2409del;2416T>C;2691G>T n/a
2 ccsbBroad304_14486 pLX_304 0% 36.3% 36.3% V5 1_2409del;2416T>C;2691G>T n/a
3 TRCN0000469041 ATCACAATTGGACGAATGGAGACG pLX_317 32.5% 36.3% 36.3% V5 1_2409del;2416T>C;2691G>T n/a
Download CSV