Transcript: Human XM_011518837.2

PREDICTED: Homo sapiens protein phosphatase 2 phosphatase activator (PTPA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPA (5524)
Length:
1468
CDS:
266..1390

Additional Resources:

NCBI RefSeq record:
XM_011518837.2
NBCI Gene record:
PTPA (5524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001121 CATACGCTGACTACATCGGAT pLKO.1 396 CDS 100% 2.640 3.696 N PTPA n/a
2 TRCN0000349491 CATACGCTGACTACATCGGAT pLKO_005 396 CDS 100% 2.640 3.696 N PTPA n/a
3 TRCN0000001120 GCCATTGAGAAACTAGTCGCT pLKO.1 587 CDS 100% 0.000 0.000 N PTPA n/a
4 TRCN0000380810 TGGATGACCAAATAGCTATTG pLKO_005 891 CDS 100% 10.800 7.560 N PTPA n/a
5 TRCN0000001119 GATCCACACAGTTCCAGACAT pLKO.1 352 CDS 100% 4.950 3.465 N PTPA n/a
6 TRCN0000318464 GATCCACACAGTTCCAGACAT pLKO_005 352 CDS 100% 4.950 3.465 N PTPA n/a
7 TRCN0000010597 GTGGATGAGAAGGCCGTGAAT pLKO.1 1085 CDS 100% 4.950 3.465 N PTPA n/a
8 TRCN0000318472 GTGGATGAGAAGGCCGTGAAT pLKO_005 1085 CDS 100% 4.950 3.465 N PTPA n/a
9 TRCN0000077224 GCTATTGTCTTCAAGGTGTTT pLKO.1 905 CDS 100% 4.950 3.465 N Ptpa n/a
10 TRCN0000301402 GCTATTGTCTTCAAGGTGTTT pLKO_005 905 CDS 100% 4.950 3.465 N Ptpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01265 pDONR223 100% 80.6% 80.6% None (many diffs) n/a
2 ccsbBroad304_01265 pLX_304 0% 80.6% 80.6% V5 (many diffs) n/a
3 TRCN0000468284 GACTCTCTTGCGACAAAGACAAAT pLX_317 36.1% 80.6% 80.6% V5 (many diffs) n/a
Download CSV