Transcript: Human XM_011518843.2

PREDICTED: Homo sapiens TBC1 domain family member 2 (TBC1D2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D2 (55357)
Length:
3298
CDS:
1522..2928

Additional Resources:

NCBI RefSeq record:
XM_011518843.2
NBCI Gene record:
TBC1D2 (55357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178781 CATCGCCTTCAATGACATGAA pLKO.1 2733 CDS 100% 4.950 3.465 N TBC1D2 n/a
2 TRCN0000181129 CTTCACCAAGACCATCTCCAA pLKO.1 2694 CDS 100% 2.640 1.848 N TBC1D2 n/a
3 TRCN0000180592 GAAGCTGATGAACATCGCCTT pLKO.1 2721 CDS 100% 2.160 1.512 N TBC1D2 n/a
4 TRCN0000183799 CATCAGTAAGTATGATGAGTA pLKO.1 1809 CDS 100% 0.495 0.347 N TBC1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12212 pDONR223 100% 99.9% 100% None 372A>G n/a
2 ccsbBroad304_12212 pLX_304 0% 99.9% 100% V5 372A>G n/a
3 TRCN0000474709 GAATAAACCAGACAGCCCTTCGGC pLX_317 41.2% 99.9% 100% V5 372A>G n/a
Download CSV