Transcript: Human XM_011518945.3

PREDICTED: Homo sapiens surfeit 4 (SURF4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SURF4 (6836)
Length:
5025
CDS:
2376..2996

Additional Resources:

NCBI RefSeq record:
XM_011518945.3
NBCI Gene record:
SURF4 (6836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153266 GCTCTTTGCCATCAACGTATA pLKO.1 2819 CDS 100% 10.800 15.120 N SURF4 n/a
2 TRCN0000119385 CTTCCTGAAATACGACTTCTT pLKO.1 2885 CDS 100% 4.950 6.930 N Surf4 n/a
3 TRCN0000152319 CATGCATGACTTCCTGAAATA pLKO.1 2876 CDS 100% 13.200 9.240 N SURF4 n/a
4 TRCN0000151853 CCCAAAGAATGATGCAGTATT pLKO.1 3551 3UTR 100% 13.200 9.240 N SURF4 n/a
5 TRCN0000154091 CCAGTGGCTTTGATGTTGTTT pLKO.1 3483 3UTR 100% 5.625 3.938 N SURF4 n/a
6 TRCN0000158134 CTTCGGGCTCTTTGGAATCAT pLKO.1 2655 CDS 100% 5.625 3.938 N SURF4 n/a
7 TRCN0000158166 CAGACGATTGCCTACAGCATT pLKO.1 2683 CDS 100% 4.950 3.465 N SURF4 n/a
8 TRCN0000158412 CCCATGCATGACTTCCTGAAA pLKO.1 2874 CDS 100% 4.950 3.465 N SURF4 n/a
9 TRCN0000157961 CTGGCTGCTTTGACTCTTGTT pLKO.1 2793 CDS 100% 4.950 3.465 N SURF4 n/a
10 TRCN0000153161 GCACCATAGTAAATGCCACAA pLKO.1 4211 3UTR 100% 4.050 2.835 N SURF4 n/a
11 TRCN0000157847 CATTCCAGTCTACAAGCCCAT pLKO.1 2858 CDS 100% 2.160 1.512 N SURF4 n/a
12 TRCN0000119384 AGCAGGAACTTCGTGCAGTAT pLKO.1 2629 CDS 100% 4.950 6.930 N Surf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01625 pDONR223 100% 73.6% 32.3% None (many diffs) n/a
2 ccsbBroad304_01625 pLX_304 0% 73.6% 32.3% V5 (many diffs) n/a
3 TRCN0000481177 CCTCAATGGGATATCTACTCTCAG pLX_317 53.3% 73.6% 32.3% V5 (many diffs) n/a
Download CSV