Transcript: Human XM_011518966.1

PREDICTED: Homo sapiens TLE family member 4, transcriptional corepressor (TLE4), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLE4 (7091)
Length:
4187
CDS:
192..2588

Additional Resources:

NCBI RefSeq record:
XM_011518966.1
NBCI Gene record:
TLE4 (7091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275238 CCTGATGGTCGCACCCTAATT pLKO_005 1893 CDS 100% 13.200 18.480 N TLE4 n/a
2 TRCN0000158555 CGTTGACAAGTGTCTTTGTAA pLKO.1 3293 3UTR 100% 5.625 4.500 N TLE4 n/a
3 TRCN0000158445 CAGTCCCATCTTCCAATTAAA pLKO.1 726 CDS 100% 15.000 10.500 N TLE4 n/a
4 TRCN0000275236 ACATCTCCGTGGACGACAAAT pLKO_005 2512 CDS 100% 13.200 9.240 N TLE4 n/a
5 TRCN0000160491 CCAGAAACATTGTGTTATCTT pLKO.1 3710 3UTR 100% 5.625 3.938 N TLE4 n/a
6 TRCN0000165843 GCAGAACTGAACGCCATCATT pLKO.1 558 CDS 100% 5.625 3.938 N TLE4 n/a
7 TRCN0000275237 GCAGAACTGAACGCCATCATT pLKO_005 558 CDS 100% 5.625 3.938 N TLE4 n/a
8 TRCN0000161958 GCCAGACAAATACCAACTACA pLKO.1 2339 CDS 100% 4.950 3.465 N TLE4 n/a
9 TRCN0000161885 GCTGTCTACTTGGAAGAACAT pLKO.1 2794 3UTR 100% 4.950 3.465 N TLE4 n/a
10 TRCN0000285323 GCTGTCTACTTGGAAGAACAT pLKO_005 2794 3UTR 100% 4.950 3.465 N TLE4 n/a
11 TRCN0000166665 CCAAAGAGACAGAGACTCCAT pLKO.1 776 CDS 100% 2.640 1.848 N TLE4 n/a
12 TRCN0000275190 CCAAAGAGACAGAGACTCCAT pLKO_005 776 CDS 100% 2.640 1.848 N TLE4 n/a
13 TRCN0000098286 CGGCATTATGTCATGTATTAT pLKO.1 384 CDS 100% 15.000 9.000 N Tle4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11192 pDONR223 100% 88.1% 88.2% None 45A>G;729_935del;1341_1415del n/a
2 ccsbBroad304_11192 pLX_304 0% 88.1% 88.2% V5 45A>G;729_935del;1341_1415del n/a
3 ccsbBroadEn_07072 pDONR223 100% 76% 83% None (many diffs) n/a
4 ccsbBroad304_07072 pLX_304 0% 76% 83% V5 (many diffs) n/a
5 TRCN0000470715 GCATCAGATGATGCAAGGCGTTCG pLX_317 14.3% 76% 83% V5 (many diffs) n/a
6 ccsbBroadEn_01676 pDONR223 100% 76% 83% None (many diffs) n/a
7 ccsbBroad304_01676 pLX_304 0% 76% 83% V5 (many diffs) n/a
8 TRCN0000472033 GTTGAGTAGATATGCCCGAGGGGC pLX_317 20.6% 76% 83% V5 (many diffs) n/a
Download CSV