Transcript: Human XM_011519003.1

PREDICTED: Homo sapiens SECIS binding protein 2 (SECISBP2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SECISBP2 (79048)
Length:
3429
CDS:
363..2606

Additional Resources:

NCBI RefSeq record:
XM_011519003.1
NBCI Gene record:
SECISBP2 (79048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230346 AGAATAGAGACACCGAAATTT pLKO_005 1302 CDS 100% 15.000 21.000 N SECISBP2 n/a
2 TRCN0000230344 ACTCTGTCTCTACCGACATTT pLKO_005 895 CDS 100% 13.200 18.480 N SECISBP2 n/a
3 TRCN0000218104 AGCTAGAGGTTCACATCATTT pLKO_005 680 CDS 100% 13.200 18.480 N SECISBP2 n/a
4 TRCN0000167026 CAGGTGTTAATCTTCTCTAAA pLKO.1 2805 3UTR 100% 13.200 18.480 N SECISBP2 n/a
5 TRCN0000134231 GCAGGTGTTAATCTTCTCTAA pLKO.1 2804 3UTR 100% 4.950 6.930 N SECISBP2 n/a
6 TRCN0000230345 TGCTAATGCCGCTACCAATTC pLKO_005 1001 CDS 100% 10.800 8.640 N SECISBP2 n/a
7 TRCN0000135298 CGCAGTTTGAATAAGGCAGTT pLKO.1 2247 CDS 100% 4.050 3.240 N SECISBP2 n/a
8 TRCN0000133997 CAGAATAGAGACACCGAAATT pLKO.1 1301 CDS 100% 13.200 9.240 N SECISBP2 n/a
9 TRCN0000137651 CACTCAGATGTGCAGGTGTTA pLKO.1 2793 3UTR 100% 4.950 3.465 N SECISBP2 n/a
10 TRCN0000230347 ACTCAGATGTGCAGGTGTTAA pLKO_005 2794 3UTR 100% 13.200 7.920 N SECISBP2 n/a
11 TRCN0000167679 GCCTCAAGAAAGAATAAGAAA pLKO.1 1170 CDS 100% 5.625 3.375 N SECISBP2 n/a
12 TRCN0000167891 CCTGTTAAAGGTCACTCAGAT pLKO.1 2781 3UTR 100% 4.950 2.970 N SECISBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466797 GGACAAAGAGTTCTATCACCGTCA pLX_317 15.2% 87.3% 87.3% V5 (many diffs) n/a
Download CSV