Transcript: Human XM_011519224.1

PREDICTED: Homo sapiens G protein subunit alpha 14 (GNA14), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNA14 (9630)
Length:
1728
CDS:
115..828

Additional Resources:

NCBI RefSeq record:
XM_011519224.1
NBCI Gene record:
GNA14 (9630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036879 CCAGAATACACAGGACCGAAA pLKO.1 625 CDS 100% 4.050 3.240 N GNA14 n/a
2 TRCN0000036882 GAAGAGAGCAAAGCCTTATTT pLKO.1 493 CDS 100% 15.000 10.500 N GNA14 n/a
3 TRCN0000036880 GCTGCTGTCAAAGACACAATT pLKO.1 772 CDS 100% 13.200 9.240 N GNA14 n/a
4 TRCN0000036883 TGCTACAGATACAGACAATAT pLKO.1 738 CDS 100% 13.200 7.920 N GNA14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14942 pDONR223 97.8% 66.6% 66.4% None 0_1ins354;699A>T n/a
2 ccsbBroad304_14942 pLX_304 0% 66.6% 66.4% V5 0_1ins354;699A>T n/a
3 TRCN0000469606 AAGCACGTCTTTTGCCCATGGCGC pLX_317 36.3% 66.5% 65.3% V5 (not translated due to prior stop codon) 0_1ins354;698delA;705delC n/a
Download CSV