Transcript: Human XM_011519385.1

PREDICTED: Homo sapiens NOP2/Sun RNA methyltransferase 6 (NSUN6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSUN6 (221078)
Length:
1885
CDS:
132..1517

Additional Resources:

NCBI RefSeq record:
XM_011519385.1
NBCI Gene record:
NSUN6 (221078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151421 GCCTTAGTAAGTCATGTACTA pLKO.1 777 CDS 100% 0.495 0.693 N NSUN6 n/a
2 TRCN0000156344 CGTCTGGCTAATAAGGACTCT pLKO.1 1452 CDS 100% 2.640 2.112 N NSUN6 n/a
3 TRCN0000151774 CTGGCTAATAAGGACTCTATA pLKO.1 1455 CDS 100% 13.200 9.240 N NSUN6 n/a
4 TRCN0000151321 GAGAAGTTATAGCACTGGATA pLKO.1 886 CDS 100% 4.950 3.465 N NSUN6 n/a
5 TRCN0000151575 GATGAACTTCAGAAGCAGTTT pLKO.1 312 CDS 100% 4.950 3.465 N NSUN6 n/a
6 TRCN0000154814 GCTCTCATGTGAACAGTTGAA pLKO.1 1343 CDS 100% 4.950 3.465 N NSUN6 n/a
7 TRCN0000151146 GCTGGAGATGTTATTTCTGTA pLKO.1 525 CDS 100% 4.950 3.465 N NSUN6 n/a
8 TRCN0000152092 CAACTGAATGATGATGTGGTT pLKO.1 1601 3UTR 100% 2.640 1.848 N NSUN6 n/a
9 TRCN0000151322 GCAAAGAAATCTTCAGTGGAT pLKO.1 637 CDS 100% 2.640 1.848 N NSUN6 n/a
10 TRCN0000151619 GCTTTAGGTAAACAAGAAGCA pLKO.1 180 CDS 100% 2.640 1.848 N NSUN6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09865 pDONR223 100% 95.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_09865 pLX_304 0% 95.7% 93.6% V5 (many diffs) n/a
3 TRCN0000472597 TCCCGCAAGCGGTTCCATTTGGCC pLX_317 28.3% 95.7% 93.6% V5 (many diffs) n/a
Download CSV